Human ECSIT cDNA Clone BC008279 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL859414HU2
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
ECSIT
Gene ID:
51295
Accession #:
BC008279
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human ECSIT cDNA Clone BC008279 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: ECSIT

Gene ID: 51295

Accession Number: BC008279

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGAGCTGGGTCCAGGCCACCCTACTGGCCCGAGGCCTCTGTAGGGCCTGGGGAGGCACCTGCGGGGCCGCCCTCACAGGAACCTCCATCTCTCAGGTCCCTCGCCGGCTCCCTCGGGGCCTCCACTGCAGCGCAGCTGCCCATAGCTCTGAACAGTCCCTGGTTCCCAGCCCACCGGAACCCCGGCAGAGGCCCACCAAGGCTCTGGTGCCCTTTGAGGACCTGTTTGGGCAGGCGCCTGGTGGGGAACGGGACAAGGCGAGCTTCCTGCAGACGGTGCAGAAATTTGCGGAGCACAGCGTGCGTAAGCGGGGCCACATTGACTTCATCTACCTGGCCCTGCGCAAGATGCGGGAGTATGGTGTCGAGCGGGACCTGGCTGTGTACAACCAGCTGCTCAACATCTTCCCCAAGGAGGTCTTCCGGCCTCGCAACATCATCCAGCGCATCTTCGTCCACTACCCTCGGCAGCAGGAGTGTGGGATTGCTGTCCTGGAGCAGATGGAGAACCACGGTGTGATGCCCAACAAGGAGACGGAGTTCCTGCTGATTCAGATCTTTGGACGCAAAAGCTACCCCATGCTCAAGTTGGTGCGCCTGAAGCTGTGGTTCCCTCGATTCATGAACGTCAACCCCTTCCCAGTGCCCCGGGACCTGCCCCAGGACCCTGTGGAGCTGGCCATGTTTGGCCTGCGGCACATGGAGCCTGACCTTAGTGCCAGGGTCACCATCTACCAGGTTCCTTTGCCCAAAGACTCAACAGGTGCAGCAGATCCCCCCCAGCCCCACATCGTAGGAAGTGGAAGAGACGCCGGAGGAGTGGAACCTCTACTACCCGATGCAGCTGGACCTGGAGTATGTGAGGAGTGGCTGGGACAACTACGAGTTTGA

Length: 891

View AllClose

0 Reviews

View AllClose