null

Human ECHDC1 cDNA Clone BC003549 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL882103HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
ECHDC1
Gene ID:
55862
Accession #:
BC003549
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human ECHDC1 cDNA Clone BC003549 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: ECHDC1

Gene ID: 55862

Accession Number: BC003549

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGGCGAAAAGTCTTTTGAAGACAGCCTCTCTGTCTGGAAGGACAAAATTGCTACATCAAACAGGATTGTCACTTTATAGTACATCCCATGGATTTTATGAGGAAGAAGTGAAAAAAACACTTCAGCAGTTTCCTGGTGGATCCATTGACCTTCAGAAGGAAGACAATGGCATTGGCATTCTTACTCTGAACAATCCAAGTAGAATGAATGCCTTTTCAGGTGTTATGATGCTACAACTTCTGGAAAAAGTAATTGAATTGGAAAATTGGACAGAGGGGAAAGGCCTCATTGTCCGTGGGGCAAAAAATACTTTCTCTTCAGGATCTGATCTGAATGCTGTGAAATCACTAGGAACTCCAGAGGATGGAATGGCCGTATGCATGTTCATGCAAAACACCTTAACAAGATTTATGAGACTTCCTTTAATAAGTGTTGCGCTGGTTCAAGGTTGGGCATTGGGTGGAGGAGCAGAATTTACTACAGCATGTGATTTCAGGTTAATGACTCCAGAGAGTAAGATCAGATTCGTCCACAAAGAGATGGGCATAATACCAAGCTGGGGTGGCACCACCCGGCTAGTTGAAATAATCGGAAGTAGACAAGCTCTCAAAGTGTTGAGTGGGGCCCTTAAACTGGATTCAAAAAATGCTCTAAACATAGGAATGGTTGAAGAGGTCTTGCAGTCTTCAGATGAAACTAAATCTCTAGAAGAGGCACAAGAATGGCTAAAGCAATTCATCCAAGGGCCACCGGAAGTAATTAGAGCTTTGAAAAAATCTGTTTGTTCAGGCAGAGAGCTATATTTGGAGGAAGCATTACAGAACGAAAGAGATCTTTTAGGAACAGTTTGGGGTGGGCCTGCAAATTTAGAGGCTATTGCTAAGAAAGGAAAATTTAATAAATAA

Length: 906

View AllClose

0 Reviews

View AllClose