null

Human DCAKD cDNA Clone BC018132 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL855481HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
DCAKD
Gene ID:
79877
Accession #:
BC018132
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human DCAKD cDNA Clone BC018132 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: DCAKD

Gene ID: 79877

Accession Number: BC018132

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGTTTCTGGTGGGCCTGACAGGGGGCATTGCCTCAGGCAAGAGCTCAGTGATCCAGGTGTTCCAGCAGCTGGGCTGTGCGGTGATTGACGTGGACGTGATGGCCCGGCACGTCGTGCAGCCAGGATACCCTGCCCACCGGCGCATCGTAGAGGTCTTCGGCACTGAGGTCTTGCTGGAGAACGGCGACATAAATCGCAAGGTCCTGGGGGACCTGATCTTTAACCAGCCTGACCGGCGGCAGCTGCTCAACGCCATCACCCACCCCGAGATTCGCAAGGAGATGATGAAGGAGACGTTCAAGTACTTCCTCCGGGGATACCGCTACGTGATTCTGGATATCCCCCTGCTGTTTGAGACCAAGAAGTTGCTCAAGTACATGAAGCACACCGTGGTAGTATACTGCGACCGGGACACACAGCTGGCACGGCTGATGCGGCGGAACAGCCTGAACCGCAAGGACGCAGAGGCCCGCATCAATGCCCAGCTGCCCCTGACAGACAAGGCCCGCATGGCCCGCCATGTCCTAGACAACTCGGGCGAGTGGAGTGTCACCAAACGCCAGGTCATCCTCTTGCACACTGAGCTGGAGCGCTCCCTGGAGTACCTGCCGCTGAGGTTTGGGGTCCTCACAGGGCTCGCTGCCATTGCCAGCCTCCTCTACCTGCTCACCCACTACCTTCTGCCTTACGCCTAG

Length: 696

View AllClose

0 Reviews

View AllClose