null

Human DAK cDNA Clone BC001341 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL659468HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
DAK
Gene ID:
26007
Accession #:
BC001341
Plasmid:
pUC
€549.00
Frequently bought together:

Description

Human DAK cDNA Clone BC001341 pUC Plasmid | Cusabio

Gene Name: DAK

Gene ID: 26007

Accession Number: BC001341

Vector: pUC

Sequence: ATGACCTCCAAGAAGCTGGTGAACTCGGTGGCTGGCTGTGCTGATGACGCTCTTGCTGGCCTGGTGGCCTGCAACCCCAACCTGCAGCTCCTGCAGGGCCACCGCGTGGCCCTCCGTTCTGACCTGGACAGCCTCAAGGGCCGGGTGGCACTGCTGTCGGGTGGGGGCTCTGGCCATGAGCCTGCCCATGCTGGTTTCATAGGGAAGGGGATGCTGACTGGGGTCATCGCGGGAGCTGTGTTCACCTCCCCGGCAGTGGGCAGCATCCTGGCAGCCATCAGGGCCGTGGCCCAGGCCGGCACAGTGGGGACGCTCCTTATCGTGAAGAACTACACTGGGGATCGGCTCAACTTCGGCCTGGCCCGGGAGCAGGCCCGGGCTGAAGGCATCCCGGTGGAGATGGTGGTGATTGGGGACGACAGCGCCTTCACTGTCCTGAAGAAGGCAGGCCGGCGGGGGCTGTGCGGCACGGTGCTTATACACAAGGTGGCAGGTGCTCTGGCTGAGGCTGGTGTGGGGCTGGAGGAGATCGCAAAGCAGGTGAACGTGGTCGCCAAGGCCATGGGTACCCTGGGGGTGAGCTTATCCTCCTGCAGCGTCCCTGGTTCCAAACCCACCTTCGAGCTCTCAGCCGACGAGGTGGAGCTGGGCCTGGGGATCCACGGGGAAGCTGGTGTGCGCCGGATAAAGATGGCAACCGCCGATGAGATTGTGAAACTCATGCTCGACCACATGACAAACACCACCAACGCGTCCCATGTGCCTGTGCAGCCCGGCTCCTCAGTTGTGATGATGGTCAACAACCTGGGTGGCCTGTCATTCCTGGAACTGGGCATCATAGCCGACGCTACCGTCCGCTCCCTGGAGGGCCGCGGGGTGAAGATTGCCCGTGCCCTGGTGGGCACCTTCATGTCAGCACTGGAGATGCCTGGCATTTCTCTCACCCTCCTGCTGGTGGATGAGCCTCTCCTGAAACTGATAGATGCTGAAACCACTGCAGCAGCCTGGCCTAACGTGGCTGCAGTCTCCATTACTGGGCGGAAGCGGAGCCGGGTAGCCCCTGCCGAGCCCCAGGAGGCCCCTGATTCCACTGCTGCAGGAGGCTCAGCCTCGAAGCGGATGGCGCTGGTGCTGGAACGGGTGTGCAGCACTCTCCTGGGCCTGGAGGAACACCTGAATGCCCTGGACCGGGCTGCTGGTGACGGCGACTGTGGCACCACCCACAGCCGTGCGGCCAGAGCAATCCAGGAGTGGCTGAAGGAGGGCCCACCCCCTGCCAGCCCTGCCCAGCTGCTCTCCAAGTTGTCTGTCCTGCTCCTGGAGAAGATGGGAGGCTCATCTGGGGCGCTCTATGGCCTGTTCCTGACTGCGGCTGCACAGCCCCTGAAGGCCAAGACCAGCCTCCCAGCCTGGTCTGCTGCCATGGATGCCGGCCTGGAAGCCATGCAGAAGTATGGCAAGGCTGCTCCAGGGGACAGGACTATGCTGGATTCTCTGTGGGCAGCGGGGCAGGAGCTCCAAGCCTGGAAGAGCCCAGGAGCTGATCTGTTACAAGTCCTGACCAAAGCAGTCAAGAGTGCCGAAGCTGCAGCCGAGGCCACCAAGAATATGGAAGCTGGAGCCGGAAGAGCCAGTTATATCAGCTCAGCACGGCTGGAGCAGCCAGACCCCGGGGCGGTGGCAGCTGCTGCCATCCTCCGGGCCATCTTGGAGGTCTTGCAGAGCTAG

Length: 1728

View AllClose

0 Reviews

View AllClose