Human BTC cDNA Clone BC011618 pENTR223.1 Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL002853HU
Availability:
3 to 5 Working Days
Size:
10 μg plasmid + 200μl Glycerol
Gene:
BTC
Gene ID:
685
Accession #:
BC011618
Plasmid:
pENTR223.1
€214.00
Frequently bought together:

Description

Human BTC cDNA Clone BC011618 pENTR223.1 Plasmid | Cusabio

Gene Name: BTC

Gene ID: 685

Accession Number: BC011618

Vector: pENTR223.1

Sequence: ATGGACCGGGCCGCCCGGTGCAGCGGCGCCAGCTCCCTGCCACTGCTCCTGGCCCTTGCCCTGGGTCTAGTGATCCTTCACTGTGTGGTGGCAGATGGGAATTCCACCAGAAGTCCTGAAACTAATGGCCTCCTCTGTGGAGACCCTGAGGAAAACTGTGCAGCTACCACCACACAATCAAAGCGGAAAGGCCACTTCTCTAGGTGCCCCAAGCAATACAAGCATTACTGCATCAAAGGGAGATGCCGCTTCGTGGTGGCCGAGCAGACGCCCTCCTGTGTCTGTGATGAAGGCTACATTGGAGCAAGGTGTGAGAGAGTTGACTTGTTTTACCTAAGAGGAGACAGAGGACAGATTCTGGTGATTTGTATGATAGCAGTTATGGTAGTTTTTATTATTTTGGTCATCGGTGTCTGCACATGCTGTCACCCTCTTCGGAAACGTCGTAAAAGAAAGAAGAAAGAAGAAGAAATGGAAACTCTGGGTAAAGATATAACTCCTATCAATGAAGATATTGAAGAGACAAATATTGCTTAA

Length: 537

View AllClose

0 Reviews

View AllClose