Human BFSP2 cDNA Clone BC113518 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL615697HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
BFSP2
Gene ID:
8419
Accession #:
BC113518
Plasmid:
pUC
€425.00
Frequently bought together:

Description

Human BFSP2 cDNA Clone BC113518 pUC Plasmid | Cusabio

Gene Name: BFSP2

Gene ID: 8419

Accession Number: BC113518

Vector: pUC

Sequence: ATGAGTGAGAGGCGAGTGGTAGTGGACTTGCCCACCAGTGCCAGCTCCAGCATGCCCCTCCAGAGGCGCAGGGCGTCCTTCAGGGGGCCACGGTCATCATCCTCCCTGGAGAGCCCCCCAGCCTCCAGGACCAATGCCATGAGTGGCCTTGTCCGAGCACCCGGGGTCTATGTAGGAACAGCACCCAGTGGGTGCATAGGTGGCTTGGGTGCCCGTGTGACCCGCCGGGCCCTCGGCATCAGCAGTGTCTTCCTTCAGGGCCTGCGGAGCTCAGGCCTGGCCACCGTGCCGGCTCCAGGTTTGGAGAGGGACCATGGTGCTGTTGAGGACCTAGGGGGCTGCCTGGTGGAATATATGGCCAAAGTGCACGCCCTTGAGCAAGTCAGTCAGGAGCTGGAAACACAACTGCGGATGCACCTGGAGAGCAAAGCCACACGCTCGGGAAACTGGGGTGCCCTACGGGCTTCCTGGGCCAGCAGCTGCCAGCAGGTGGGTGAGGCAGTCTTGGAAAATGCCCGGCTCATGCTGCAGACAGAAACTATCCAGGCCGGAGCAGATGACTTTAAAGAGAGATATGAAAATGAGCAGCCATTTCGAAAGGCAGCAGAAGAGGAAATTAACTCTCTGTATAAAGTCATTGATGAGGCTAATTTGACTAAAATGGACCTGGAGAGTCAAATAGAAAGTCTGAAAGAAGAACTTGGCTCTCTATCAAGAAACTATGAAGAGGATGTGAAGCTGCTGCACAAACAGTTGGCAGGGTGTGAGCTGGAACAAATGGATGCTCCCATTGGCACTGGTCTGGACGACATCCTTGAGACGATCAGAATTCAGTGGGAGAGAGATGTTGAAAAGAACCGGGTGGAGGCAGGAGCCCTGCTCCAAGCTAAGCAACAGGCGGAGGTGGCCCACATGTCCCAGACCCAGGAGGAGAAGCTGGCAGCTGCCCTCAGGGTGGAGTTACACAACACTTCGTGCCAAGTCCAGAGCCTCCAGGCTGAGACAGAATCCTTACGTGCCCTGAAACGAGGCCTGGAGAACACCTTGCACGATGCCAAGCACTGGCATGACATGGAGCTCCAGAACCTGGGCGCTGTGGTCGGCCGGCTGGAGGCGGAGCTCAGGGAAATCCGAGCGGAGGCGGAGCAGCAGCAACAGGAGCGCGCGCATCTGCTGGCCCGCAAGTGCCAGCTGCAGAAGGACGTGGCGTCCTACCACGCCCTGCTGGACAGGGAGGAGAGCGGCTGA

Length: 1248

View AllClose

0 Reviews

View AllClose