null

Human BBX cDNA Clone BC131718 pENTR223.1 Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL845172HU
Availability:
3 to 5 Working Days
Size:
10 μg plasmid + 200μl Glycerol
Gene:
BBX
Gene ID:
56987
Accession #:
BC131718
Plasmid:
pENTR223.1
€214.00
Frequently bought together:

Description

Human BBX cDNA Clone BC131718 pENTR223.1 Plasmid | Cusabio

Gene Name: BBX

Gene ID: 56987

Accession Number: BC131718

Vector: pENTR223.1

Sequence: ATGAAAGGCAGTAATAGAAATAAGGATCATTCAGCAGAAGGAGAAGGGGTTGGAAAACGACCAAAACGAAAGTGTCTTCAGTGGCATCCATTGCTAGCAAAGAAACTTCTTGATTTTTCAGAAGAGGAAGAAGAGGAAGACGAAGAGGAGGATATTGATAAGGTTCAACTTCTTGGGGCCGATGGCCTAGAGCAAGATGTTGGTGAAACTGAAGATGATGAATCACCAGAGCAGCGAGCCCGGAGACCAATGAATGCATTTCTTTTATTTTGCAAACGCCATCGCTCTCTTGTACGTCAGGAACACCCCAGGCTTGATAACCGAGGTGCTACCAAGATACTAGCTGATTGGTGGGCTGTTCTTGATCCAAAGGAAAAGCAGAAATACACAGACATGGCCAAGGAGTATAAGGATGCATTTATGAAAGCAAATCCTGGCTACAAATGGTGTCCTACCACAAACAAGCCTGTGAAATCCCCAACACCCACTGTCAATCCACGAAAGAAACTTTGGGCCTTCCCATCTGACTCTTCAAGAGACTTGCCAAGCCCCAAGAAAGCAAAGACTGAAGAAATGCCTCAGCTTAACTTTGGAATGGCTGATCCTACTCAAATGGGAGGCCTGAGTATGCTGCTGTTAGCTGGAGAACATGCTCTTGGCACACCAGAGGTATCCTCTGGCACATGCAGGCCTGATGTTTCAGAATCTCCTGAATTACGTCAGAAGTCACCATTGTTTCAGTTTGCCGAGATATCTTCAAGTACGTCCCACTCTGATGCTTCTACAAAGCAGTGTCAAACATCTGCCTTGTTTCAGTTTGCAGAGATTTCTTCAAACACTTCGCAGTTGGGTGGTGCTGAGCCTGTAAAACGCTGTGGAAAGTCTGCACTCTTTCAACTGGCAGAGGAAAACGAAGCTCAGGAAAAGGAAACTCCTCTGATCATGAAGGGTGTTGGAATGAAGAAAGCTGGACATTTAGTCAGAGTGGGACCAGTGGGAGCAAGAAGTTCAAGAAGACAAAGCCAAAAGAAGACTGTCTCCTTGGCTCCGCAAAGCTGGATGAAGAATTTGAAAAAAAATTCAACAGCCTCCCTCAATATAGTCCTGTTACATTTGACCGGAAATGTGTACCTGTCCCAAGAAAAAAGAAGAAGACTGGAAATGTGTCCTCAGAACCGACTAAAACCAGCAAAGGTCCTTTCCAGTCTCAGAAAAAGAACTTATTCCACAAAATTGTCAGCAAATATAAGCACAAAAAGGAGAAGCCCAATGTTCCGGAAAAAGGAAGTGGGGATAAATGGTCAAACAAGCAACTCTTCTTGGATGCCATTCACCCTACAGAAGCCATATTTTCAGAAGACAGAAACACCATGGAGCCTGTTCATAAGGTTAAAAATATCCCATCCATTTTCAACACTCCAGAGCCAACAACAACGCAAGAACCTTTGGTGGGCAGCCAAAAGAGAAAAGCAAGGAAAACCAAGATTACACACCTTGTCAGGACAGCAGATGGCCGGGTATCACCAGCAGGAGGTACTTTGGATGACAAACCAAAGGAACAACTGCAGAGGAGTCTCCCTAAAGCAACTGAGACAGACTGCAATGACAAATGCTCACACAACACCGAGGTCGGGGAGACGCGGAGCAGTACTCCAGAAATGCCTGCCGTGTCTGCGTTCTTTAGCCTCGCTGCGCTGGCTGAAGTGGCAGCCATGGAAAATGTGCACAGAGGTCAGAGGTCAACTCCGCTCACCCATGATGGACAGCCAAAAGAAATGCCGCAGGCTCCTGTACTTATTTCCTGCGCTGACCAGTGAAGCGCCCTTTCATTGTAAAACATTGTGCTTTACCTACTACCCTAGCCTTGTCTTTACCGAGGGATGCTAG

Length: 1887

View AllClose

0 Reviews

View AllClose