Human BAG3 cDNA Clone BC006418 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL002531HU1
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
BAG3
Gene ID:
9531
Accession #:
BC006418
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€347.00
Frequently bought together:

Description

Human BAG3 cDNA Clone BC006418 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: BAG3

Gene ID: 9531

Accession Number: BC006418

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGAGCGCCGCCACCCACTCGCCCATGATGCAGGTGGCGTCCGGCAACGGTGACCGCGACCCTTTGCCCCCCGGATGGGAGATCAAGATCGACCCGCAGACCGGCTGGCCCTTCTTCGTGGACCACAACAGCCGCACCACTACGTGGAACGACCCGCGCGTGCCCTCTGAGGGCCCCAAGGAGACTCCATCCTCTGCCAATGGCCCTTCCCGGGAGGGCTCTAGGCTGCCGCCTGCTAGGGAAGGCCACCCTGTGTACCCCCAGCTCCGACCAGGCTACATTCCCATTCCTGTGCTCCATGAAGGCGCTGAGAACCGGCAGGTGCACCCTTTCCATGTCTATCCCCAGCCTGGGATGCAGCGATTCCGAACTGAGGCGGCAGCAGCGGCTCCTCAGAGGTCCCAGTCACCTCTGCGGGGCATGCCAGAAACCACTCAGCCAGATAAACAGTGTGGACAGGTGGCAGCGGCGGCGGCAGCCCAGCCCCCAGCCTCCCACGGACCTGAGCGGTCCCAGTCTCCAGCTGCCTCTGACTGCTCATCCTCATCCTCCTCGGCCAGCCTGCCTTCCTCCGGCAGGAGCAGCCTGGGCAGTCACCAGCTCCCGCGGGGGTACATCTCCATTCCGGTGATACACGAGCAGAACGTTACCCGGCCAGCAGCCCAGCCCTCCTTCCACCAAGCCCAGAAGACGCACTACCCAGCGCAGCAGGGGGAGTACCAGACCCACCAGCCTGTGTACCACAAGATCCAGGGGGATGACTGGGAGCCCCGGCCCCTGCGGGCGGCATCCCCGTTCAGGTCATCTGTCCAGGGTGCATCGAGCCGGGAGGGCTCACCAGCCAGGAGCAGCACGCCACTCCACTCCCCCTCGCCCATCCGTGTGCACACCGTGGTCGACAGGCCTCAGCAGCCCATGACCCATCGAGAAACTGCACCTGTTTCCCAGCCTGAAAACAAACCAGAAAGTAAGCCAGGCCCAGTTGGACCAGAACTCCCTCCTGGACACATCCCAATTCAAGTGATCCGCAAAGAGGTGGATTCTAAACCTGTTTCCCAGAAGCCCCCACCTCCCTCTGAGAAGGTAGAGGTGAAAGTTCCCCCTGCTCCAGTTCCTTGTCCTCCTCCCAGCCCTGGCCCTTCTGCTGTCCCCTCTTCCCCCAAGAGTGTGGCTACAGAAGAGAGGGCAGCCCCCAGCACTGCCCCTGCAGAAGCTACACCTCCAAAACCAGGAGAAGCCGAGGCTCCCCCAAAACATCCAGGAGTGCTGAAAGTGGAAGCCATCCTGGAGAAGGTACAGGGGCTGGAGCAGGCTGTAGACAACTTTGAAGGCAAGAAGACTGACAAAAAGTACCTGATGATCGAAGAGTATTTGACCAAAGAGCTGCTGGCCCTGGATTCAGTGGACCCCGAGGGACGAGCCGATGTGCGTCAGGCCAGGAGAGACGGTGTCAGGAAGGTTCAGACCATCTTGGAAAAACTTGAACAGAAAGCCATTGATGTCCCAGGTCAAGTCCAGGTCTATGAACTCCAGCCCAGCAACCTTGAAGCAGATCAGCCACTGCAGGCAATCATGGAGATGGGTGCCGTGGCAGCAGACAAGGGCAAGAAAAATGCTGGAAATGCAGAAGATCCCCACACAGAAACCCAGCAGCCAGAAGCCACAGCAGCAGCGACTTCAAACCCCAGCAGCATGACAGACACCCCTGGTAACCCAGCAGCACCGTAG

Length: 1728

View AllClose

0 Reviews

View AllClose