Human ADCY10 cDNA Clone BC117366 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL839393HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
ADCY10
Gene ID:
55811
Accession #:
BC117366
Plasmid:
pUC
€1,743.00
Frequently bought together:

Description

Human ADCY10 cDNA Clone BC117366 pUC Plasmid | Cusabio

Gene Name: ADCY10

Gene ID: 55811

Accession Number: BC117366

Vector: pUC

Sequence: ATGAACACTCCAAAAGAAGAATTCCAGGACTGGCCCATAGTCAGAATAGCAGCTCATTTACCAGACCTCATTGTCTATGGACATTTCTCCCCAGAGCGACCCTTTATGGATTATTTTGACGGAGTCCTGATGTTTGTTGATATTTCAGGTTTTACTGCAATGACTGAGAAGTTCAGCAGTGCCATGTACATGGACAGAGGGGCTGAGCAGTTGGTGGAGATCCTCAACTACCACATAAGTGCAATAGTGGAGAAAGTGTTGATTTTTGGAGGAGACATCCTGAAATTTGCAGGTGATGCACTGCTAGCCCTGTGGAGGGTGGAGCGAAAGCAGCTGAAAAACATTATCACAGTGGTAATTAAATGTAGCCTGGAGATCCATGGATTGTTTGAGACCCAGGAGTGGGAAGAAGGCCTAGACATCCGAGTCAAGATAGGACTGGCTGCTGGCCACATCAGCATGTTGGTCTTTGGAGATGAAACACACAGCCACTTTCTGGTGATTGGTCAGGCAGTGGACGATGTGCGCCTTGCCCAGAACATGGCTCAGATGAATGATGTTATTCTGTCACCAAACTGCTGGCAGCTCTGTGACCGGAGCATGATTGAAATTGAGAGTGTTCCAGATCAGAGAGCAGTTAAGGTTAACTTCTTAAAACCACCCCCCAATTTTAATTTTGATGAATTTTTCACAAAGTGTACGACCTTCATGCATTATTATCCTTCTGGTGAGCACAAAAACCTCCTGAGGCTTGCATGCACGCTGAAGCCTGATCCTGAACTGGAGATGTCCCTACAAAAGTATGTGATGGAAAGCATTTTGAAGCAGATTGATAACAAACAGCTTCAGGGCTATTTATCTGAGCTTCGCCCAGTGACGATTGTGTTTGTGAACCTGATGTTTGAAGACCAAGACAAAGCAGAAGAGATAGGCCCAGCCATCCAGGATGCCTATATGCACATCACTTCTGTCCTGAAGATCTTCCAAGGCCAAATCAATAAAGTCTTCATGTTTGACAAGGGCTGCTCTTTCCTCTGTGTCTTTGGCTTCCCTGGGGAAAAGGTACCTGACGAGCTCACTCATGCTCTGGAATGTGCTATGGATATATTTGACTTCTGCTCTCAAGTCCACAAAATCCAAACTGTATCCATCGGTGTTGCCAGTGGGATTGTCTTCTGTGGGATCGTTGGACACACTGTGAGACACGAGTACACAGTCATTGGTCAAAAAGTCAACTTAGCTGCCAGGATGATGATGTACTACCCAGGAATTGTGACCTGCGACTCTGTCACCTACAATGGGAGCAACCTACCAGCGTACTTTTTTAAAGAGCTTCCAAAGAAAGTTATGAAAGGTGTTGCAGATTCTGGACCATTGTATCAGTATTGGGGCCGTACTGAGAAAGTCATGTTTGGTATGGCGTGCCTCATCTGCAACAGAAAGGAGGATTACCCTTTGCTGGGACGTAATAAAGAGATCAACTACTTCATGTATACTATGAAGAAATTTTTGATATCTAACAGCAGCCAAGTCTTAATGTATGAGGGATTACCAGGATATGGAAAAAGCCAGATACTTATGAAAATTGAGTACCTGGCCCAAGGTAAGAATCACAGGATTATTGCCATTTCATTGAATAAGATCAGCTTCCATCAAACTTTCTATACCATCCAGATGTTCATGGCCAATGTCCTAGGCCTAGACACTTGTAAACATTATAAAGAACGACAGACCAACCTTCGAAATAAAGTCATGACACTGTTGGATGAAAAGTTCTACTGTCTTCTTAATGACATTTTCCATGTTCAGTTCCCTATTTCTCGGGAGATTTCCAGGATGAGCACCTTGAAAAAGCAAAAACAATTGGAAATATTGTTTATGAAGATCTTGAAGCTGATAGTGAAAGAGGAAAGGATTATTTTTATCATTGATGAGGCCCAGTTTGTGGATTCGACCTCCTGGAGATTTATGGAGAAGCTTATCCGGACTCTTCCTATCTTCATCATTATGTCCCTGTGTCCCTTCGTTAACATTCCCTGTGCAGCTGCCAGGGCCGTAATAAAGAACAGGAACACCACCTACATTGTCATTGGTGCAGTACAGCCTAACGACATCTCCAACAAGATCTGTCTTGACCTCAATGTGAGCTGCATCTCCAAAGAACTGGACTCGTACCTGGGGGAGGGAAGCTGTGGGATTCCATTTTACTGTGAAGAATTGCTTAAAAACCTGGAACATCATGAGGTACTCGTTTTCCAACAAACGGAGTCTGAGGAAAAGACAAATAGGACCTGGAATAACCTGTTCAAGTATTCCATTAAGCTAACAGAGAAGTTAAACATGGTTACTCTCCATAGTGATAAGGAAAGTGAAGAAGTCTGTCACCTCACAAGTGGCGTCAGACTGAAAAACCTGTCACCTCCAACGTCATTAAAAGAAATCTCTCTGATCCAGCTGGATAGCATGAGACTTTCCCACCAAATGCTGGTGAGATGTGCTGCCATCATTGGCCTGACCTTCACCACTGAGTTGTTGTTTGAGATTCTCCCCTGTTGGAATATGAAGATGATGATCAAGACCCTGGCAACCCTAGTGGAATCTAACATTTTTTATTGTTTCCGGAATGGCAAGGAGCTTCAAAAGGCCCTGAAACAGAATGATCCCTCATTTGAGGTGCACTATCGTTCCTTGTCTCTGAAGCCCAGTGAAGGGATGGATCACGGTGAAGAGGAACAGCTTCGTGAACTGGAGAATGAGGTGATCGAGTGCCACAGGATTCGATTCTGTAACCCTATGATGCAGAAAACAGCCTACGAGCTGTGGCTCAAGGACCAGAGAAAAGCCATGCACTTGAAATGTGCCCGCTTTTTAGAAGAAGATGCCCACAGATGTGACCACTGCCGAGGCAGGGACTTCATTCCCTATCATCACTTCACAGTGAATATTCGGCTCAACGCTTTAGACATGGATGCCATTAAAAAGATGGCTATGTCTCATGGATTTAAAACTGAAGAAAAGCTTATCTTGTCCAACTCAGAGATTCCTGAGACATCTGCATTTTTTCCTGAAAATCGCAGTCCTGAAGAAATAAGAGAAAAGATCTTGAATTTCTTTGACCACGTTTTAACAAAAATGAAGACATCTGACGAAGACATTATCCCTCTGGAATCTTGCCAGTGTGAAGAAATCCTAGAGATTGTCATCTTGCCTCTGGCCCACCATTTTCTGGCTTTGGGAGAAAATGACAAAGCCTTATATTACTTCTTAGAAATTGCATCTGCTTATCTCATCTTTTGTGATAACTACATGGCATACATGTATTTGAATGAAGGACAGAAGTTGCTAAAAACTCTCAAGAAGGACAAATCTTGGAGCCAGACATTTGAGTCTGCCACCTTTTACAGCCTCAAAGGTGAGGTCTGTTTCAATATGGGCCAGATAGTGCTTGCCAAGAAAATGCTGAGGAAGGCACTGAAGCTCCTCAACCGAATCTTTCCTTACAACTTAATCTCCTTGTTTCTCCATATCCATGTCGAGAAAAACAGACACTTTCATTATGTGAATCGGCAGGCCCAAGAGAGCCCACCTCCAGGGAAGAAGAGGCTGGCACAACTTTACCGGCAAACTGTCTGCCTTTCCTTGCTGTGGCGCATCTATAGCTACAGTTATCTTTTTCACTGCAAGTATTATGCCCACCTGGCAGTTATGATGCAAATGAATACTGCACTGGAAACTCAAAATTGTTTCCAGATCATTAAGGCTTACCTAGACTATTCGCTATACCACCACCTGGCTGGCTACAAAGGTGTGTGGTTCAAATATGAAGTCATGGCCATGGAGCACATCTTCAACCTCCCCCTGAAAGGCGAGGGCATTGAAATCGTGGCATACGTGGCTGAGACACTGGTCTTCAACAAGCTCATAATGGGACACCTGGATTTGGCCATTGAGTTAGGCTCCCGAGCCCTTCAGATGTGGGCACTGCTCCAGAATCCCAACCGACATTATCAGTCCCTCTGCAGACTTAGCAGATGTCTCCTTCTGAACAGCAGATACCCGCAATTGATCCAGGTGCTGGGGCGGCTGTGGGAGCTTTCTGTAACACAGGAACACATCTTCAGCAAGGCATTTTTCTATTTTGTCTGCTTGGACATCCTGCTTTATTCTGGTTTTGTTTATAGAACATTTGAAGAATGTTTGGAATTCATACACCAATACGAAAACAACAGAATCCTCAAGTTCCACAGTGGACTCCTCCTGGGACTTTATTCCTCTGTAGCTATCTGGTATGCCAGACTTCAGGAATGGGACAACTTTTACAAATTTTCCAATAGAGCTAAAAATCTTTTGCCAAGAAGAACCATGACACTTACTTACTATGACGGAATATCTAGGTACATGGAGGGGCAAGTTCTTCACCTTCAAAAACAAATCAAAGAACAGTCAGAGAATGCCCAAGCCAGTGGGGAGGAGCTACTCAAGAACTTGGAGAATCTGGTGGCTCAAAATACCACTGGCCCTGTCTTTTGCCCAAGGCTCTACCACCTGATGGCTTACGTCTGTATATTAATGGGAGATGGGCAGAAATGTGGCCTCTTCCTGAACACAGCCTTGCGGCTCTCTGAAACACAGGGGAATATACTGGAGAAATGCTGGCTGAACATGAACAAAGAATCATGGTACTCAACCTCTGAGTTAAAAGAAGACCAATGGCTTCAGACGATCTTGAGTCTCCCATCATGGGAAAAAATTGTAGCAGGCAGGGTAAACATTCAGGATCTTCAAAAAAACAAATTCCTGATGAGAGCTAATACCGTGGACAATCATTTCTAA

Length: 4833

View AllClose

0 Reviews

View AllClose