Human ADAM23 cDNA Clone BC132763 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL001285HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
ADAM23
Gene ID:
8745
Accession #:
BC132763
Plasmid:
pUC
€750.00
Frequently bought together:

Description

Human ADAM23 cDNA Clone BC132763 pUC Plasmid | Cusabio

Gene Name: ADAM23

Gene ID: 8745

Accession Number: BC132763

Vector: pUC

Sequence: ATGAAGCCGCCCGGCAGCAGCTCGCGGCAGCCGCCCCTGGCGGGCTGCAGCCTTGCCGGCGCTTCCTGCGGCCCCCAACGCGGCCCCGCCGGCTCGGTGCCTGCCAGCGCCCCGGCCCGCACGCCGCCCTGCCGCCTGCTTCTCGTCCTTCTCCTGCTGCCTCCGCTCGCCGCCTCGTCCCGGCCCCGCGCCTGGGGGGCTGCTGCGCCCAGCGCTCCGCATTGGAATGAAACTGCAGAAAAAAATTTGGGAGTCCTGGCAGATGAAGACAATACATTGCAACAGAATAGCAGCAGTAATATCAGTTACAGCAATGCAATGCAGAAAGAAATCACACTGCCTTCAAGACTCATATATTACATCAACCAAGACTCGGAAAGCCCTTATCACGTTCTTGACACAAAGGCAAGACACCAGCAAAAACATAATAAGGCTGTCCATCTGGCCCAGGCAAGCTTCCAGATTGAAGCCTTCGGCTCCAAATTCATTCTTGACCTCATACTGAACAATGGTTTGTTGTCTTCTGATTATGTGGAGATTCACTACGAAAATGGGAAACCACAGTACTCTAAGGGTGGAGAGCACTGTTACTACCATGGAAGCATCAGAGGCGTCAAAGACTCCAAGGTGGCTCTGTCAACCTGCAATGGACTTCATGGCATGTTTGAAGATGATACCTTCGTGTATATGATAGAGCCACTAGAGCTGGTTCATGATGAGAAAAGCACAGGTCGACCACATATAATCCAGAAAACCTTGGCAGGACAGTATTCTAAGCAAATGAAGAATCTCACTATGGAAAGAGGTGACCAGTGGCCCTTTCTCTCTGAATTACAGTGGTTGAAAAGAAGGAAGAGAGCAGTGAATCCATCACGTGGTATATTTGAAGAAATGAAATATTTGGAACTTATGATTGTTAATGATCACAAAACGTATAAGAAGCATCGCTCTTCTCATGCACATACCAACAACTTTGCAAAGTCCGTGGTCAACCTTGTGGATTCTATTTACAAGGAGCAGCTCAACACCAGGGTTGTCCTGGTGGCTGTAGAGACCTGGACTGAGAAGGATCAGATTGACATCACCACCAACCCTGTGCAGATGCTCCATGAGTTCTCAAAATACCGGCAGCGCATTAAGCAGCATGCTGATGCTGTGCACCTCATCTCGCGGGTGACATTTCACTATAAGAGAAGCAGTCTGAGTTACTTTGGAGGTGTCTGTTCTCGCACAAGAGGAGTTGGTGTGAATGAGTATGGTCTTCCAATGGCAGTGGCACAAGTATTATCGCAGAGCCTGGCTCAAAACCTTGGAATCCAATGGGAACCTTCTAGCAGAAAGCCAAAATGTGACTGCACAGAATCCTGGGGTGGCTGCATCATGGAGGAAACAGGGGTGTCCCATTCTCGAAAATTTTCAAAGTGCAGCATTTTGGAGTATAGAGACTTTTTACAGAGAGGAGGTGGAGCCTGCCTTTTCAACAGGCCAACAAAGCTATTTGAGCCCACGGAATGTGGAAATGGATACGTGGAAGCTGGGGAGGAGTGTGATTGTGGTTTTCATGTGGAATGCTATGGATTATGCTGTAAGAAATGTTCCCTCTCCAACGGGGCTCACTGCAGCGACGGGCCCTGCTGTAACAATACCTCATGTCTTTTTCAGCCACGAGGGTATGAATGCCGGGATGCTGTGAACGAGTGTGATATTACTGAATATTGTACTGGAGACTCTGGTCAGTGCCCACCAAATCTTCATAAGCAAGACGGATATGCATGCAATCAAAATCAGGGCCGCTGCTACAATGGCGAGTGCAAGACCAGAGACAACCAGTGTCAGTACATCTGGGGAACAAAGGCTGCAGGGTCTGACAAGTTCTGCTATGAAAAGCTGAATACAGAAGGCACTGAGAAGGGAAACTGCGGGAAGGATGGAGACCGGTGGATTCAGTGCAGCAAACATGATGTGTTCTGTGGATTCTTACTCTGTACCAATCTTACTCGAGCTCCACGTATTGGTCAACTTCAGGGTGAGATCATTCCAACTTCCTTCTACCATCAAGGCCGGGTGATTGACTGCAGTGGTGCCCATGTAGTTTTAGATGATGATACGGATGTGGGCTATGTAGAAGATGGAACGCCATGTGGCCCGTCTATGATGTGTTTAGATCGGAAGTGCCTACAAATTCAAGCCCTAAATATGAGCAGCTGTCCACTCGATTCCAAGGGTAAAGTCTGTTCGGGCCATGGGGTGTGTAGTAATGAAGCCACCTGCATTTGTGATTTCACCTGGGCAGGGACAGATTGCAGTATCCGGGATCCAGTTAGGAACCTTCACCCCCCCAAGGATGAAGGACCCAAGGGTCCTAGTGCCACCAATCTCATAATAGGCTCCATCGCTGGTGCCATCCTGGTAGCAGCTATTGTCCTTGGGGGCACAGGCTGGGGATTTAAAAATGTCAAGAAGAGAAGGTTCGATCCTACTCAGCAAGGCCCCATCTGA

Length: 2499

View AllClose

0 Reviews

View AllClose