null

Human ADAL cDNA Clone BC075857 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL724932HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
ADAL
Gene ID:
161823
Accession #:
BC075857
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human ADAL cDNA Clone BC075857 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: ADAL

Gene ID: 161823

Accession Number: BC075857

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGATAGAGGCAGAAGAGCAACAGCCTTGCAAGACAGACTTCTATTCTGAATTGCCAAAAGTGGAACTTCATGCCCACTTGAATGGATCCATTAGTTCTCATACCATGAAGAAATTAATAGCCCAGAAGCCAGATCTTAAAATCCACGATCAGATGACTGTGATTGACAAGGGAAAGAAAAGAACTTTGGAAGAATGTTTCCAGATGTTTCAAACTATTCATCAGCTTACTAGTAGCCCTGAAGATATTCTAATGGTCACAAAAGATGTCATAAAAGAATTTGCAGATGACGGCGTCAAGTACCTGGAACTAAGGAGCACACCCAGAAGAGAAAATGCTACCGGAATGACTAAAAAGACTTATGTGGAATCTATACTTGAAGGTATAAAACAGTCCAAACAAGAAAACTTGGACATTGATGTTAGGTATTTGATAGCAGTTGACAGAAGAGGTGGCCCTTTAGTAGCCAAGGAGACTGTAAAACTTGCCGAGGAGTTCTTCCTTTCTACTGAGGGTACAGTTCTTGGCCTTGACCTCAGTGGAGACCCTACTGTAGGACAAGCAAAAGACTTCTTGGAACCTCTTTTAGAAGCTAAGAAAGCAGGTCTGAAGTTAGCATTGCATCTTTCAGAGATTCCAAACCAAAAAAAAGAAACACAAATACTCCTGGATCTGCTTCCTGACAGAATCGGGCATGGAACATTTCTCAACTCCGGTGAGGGAGGATCCCTGGATCTGGTGGACTTTGTGAGGCAACATCGGATACCACTGGGTAAGGCTTGGAGTTTCAGGTCTTCCAGATGA

Length: 804

View AllClose

0 Reviews

View AllClose