Human ABP1 cDNA Clone BC014093 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL001111HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
ABP1
Gene ID:
26
Accession #:
BC014093
Plasmid:
pUC
€686.00
Frequently bought together:

Description

Human ABP1 cDNA Clone BC014093 pUC Plasmid | Cusabio

Gene Name: ABP1

Gene ID: 26

Accession Number: BC014093

Vector: pUC

Sequence: ATGCCGGCCCTGGGCTGGGCCGTGGCTGCCATCCTGATGCTGCAGACGGCCATGGCGGAGCCCTCCCCGGGGACTCTGCCCAGGAAGGCAGGGGTGTTTTCAGACCTAAGCAACCAAGAGCTGAAGGCAGTGCACAGCTTCCTCTGGTCCAAGAAGGAGCTGAGGCTGCAGCCCTCCAGTACCACCACCATGGCCAAGAACACCGTGTTTCTCATCGAGATGCTGCTGCCCAAGAAGTACCATGTGCTGAGGTTTCTGGATAAAGGTGAAAGGCATCCTGTGCGGGAAGCCCGTGCCGTCATCTTCTTTGGTGACCAGGAGCATCCCAATGTCACCGAGTTTGCTGTGGGGCCCCTGCCAGGGCCCTGCTACATGCGAGCACTGTCCCCCAGGCCTGGGTACCAGTCCTCCTGGGCATCGAGGCCCATCTCCACAGCAGAGTATGCCCTCCTCTACCACACCCTGCAGGAAGCCACCAAGCCCCTGCATCAGTTCTTCCTCAATACCACAGGCTTCTCATTCCAAGACTGCCATGACAGATGCCTGGCCTTCACCGATGTGGCCCCCCGGGGTGTGGCTTCTGGCCAGCGCCGCAGTTGGCTTATCATACAGCGCTATGTAGAAGGCTACTTTCTGCACCCCACTGGGCTGGAGCTCCTCGTGGATCATGGGAGCACAGATGCTGGGCACTGGGCCGTGGAGCAGGTGTGGTACAACGGGAAGTTCTATGGGAGCCCAGAGGAACTGGCTCGGAAGTATGCAGATGGAGAGGTGGACGTGGTGGTCCTGGAGGACCCGCTGCCTGGGGGCAAGGGGCATGACAGCACAGAGGAGCCGCCCCTCTTCTCCTCCCACAAGCCCCGCGGGGACTTCCCCAGCCCCATCCATGTGAGCGGCCCCCGCTTGGTCCAGCCCCACGGCCCTCGCTTCAGGCTGGAGGGCAACGCTGTGCTCTACGGCGGCTGGAGCTTTGCCTTCCGGCTGCGCTCCTCCTCCGGGCTGCAGGTCCTGAACGTGCACTTCGGCGGAGAGCGCATTGCCTATGAGGTCAGCGTGCAAGAGGCAGTGGCGCTGTATGGAGGACACACACCTGCAGGCATGCAGACCAAGTACCTCGATGTCGGCTGGGGCCTGGGCAGCGTCACTCATGAGTTAGCCCCCGGCATCGACTGCCCGGAGACCGCCACCTTCCTGGACACTTTCCACTACTATGATGCCGATGACCCGGTCCATTATCCCCGAGCCCTCTGCCTCTTTGAAATGCCCACAGGGGTGCCCCTTCGGCGGCACTTTAATTCCAACTTTAAAGGTGGCTTCAACTTCTATGCAGGGCTGAAGGGCCAGGTGCTGGTGCTGCGGACAACTTCAACTGTCTACAATTATGATTACATTTGGGACTTTATCTTCTACCCCAACGGGGTGATGGAGGCCAAGATGCATGCCACTGGCTACGTCCACGCCACCTTCTACACCCCCGAGGGGCTGCGCCACGGCACTCGCCTGCACACCCACCTGATTGGCAACATACACACTCACTTGGTGCACTACCGCGTAGACCTGGATGTGGCAGGCACCAAGAACAGCTTCCAGACACTGCAGATGAAGCTAGAAAACATCACCAACCCCTGGAGCCCGAGACACCGCGTGGTCCAGCCAACTCTGGAGCAGACGCAGTACTCCTGGGAGCGCCAGGCGGCCTTCCGCTTCAAAAGGAAGCTGCCCAAGTACCTGCTCTTTACCAGCCCCCAGGAGAACCCCTGGGGCCACAAGCGCAGCTACCGCCTGCAGATCCACTCCATGGCCGACCAGGTGCTGCCCCCAGGCTGGCAGGAGGAGCAGGCCATCACCTGGGCAAGGTACCCCCTGGCAGTGACCAAGTACCGGGAGTCAGAGCTGTGCAGCAGCAGCATCTACCACCAGAACGACCCCTGGGACCCGCCCGTGGTCTTTGAGCAGTTTCTTCACAACAACGAGAACATTGAAAATGAGGACCTGGTGGCCTGGGTGACGGTGGGCTTCCTGCACATCCCCCACTCAGAGGACATTCCCAACACAGCCACACCTGGGAACTCCGTGGGCTTCCTGCTCCGGCCATTCAACTTCTTCCCAGAGGACCCCTCCCTGGCATCCAGAGACACTGTGATCGTGTGGCCTCGGGACAACGGCCCCAACTACGTCCAGCGCTGGATCCCTGAGGACAGGGACTGCTCGATGCCTCCCCCTTTTAGCTACAATGGGACCTATAGACCTGTGTGA

Length: 2256

View AllClose

0 Reviews

View AllClose