Human ABCB6 cDNA Clone BC000559 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL889063HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
ABCB6
Gene ID:
10058
Accession #:
BC000559
Plasmid:
pUC
€757.00
Frequently bought together:

Description

Human ABCB6 cDNA Clone BC000559 pUC Plasmid | Cusabio

Gene Name: ABCB6

Gene ID: 10058

Accession Number: BC000559

Vector: pUC

Sequence: ATGGTGACTGTGGGCAACTACTGCGAGGCCGAAGGGCCCGTGGGTCCGGCCTGGATGCAGGATGGCCTGAGTCCCTGCTTCTTCTTCACGCTCGTGCCCTCGACGCGGATGGCTCTAGGGACTCTGGCCTTGGTGCTGGCTCTTCCCTGCAGACGCCGGGAGCGGCCCGCTGGTGCTGATTCGCTGTCTTGGGGGGCCGGCCCTCGCATCTCTCCCTACGTGCTGCAGCTGCTTCTGGCCACACTTCAGGCGGCGCTGCCCCTGGCCGGCCTGGCTGGCCGGGTGGGCACTGCCCGGGGGGCCCCACTGCCAAGCTATCTACTTCTGGCCTCCGTGCTGGAGAGTCTGGCCGGCGCCTGTGGCCTGTGGCTGCTTGTCGTGGAGCGGAGCCAGGCACGGCAGCGTCTGGCAATGGGCATCTGGATCAAGTTCAGGCACAGCCCTGGTCTCCTGCTCCTCTGGACTGTGGCGTTTGCAGCTGAGAACTTGGCCCTGGTGTCTTGGAACAGCCCACAGTGGTGGTGGGCAAGGGCAGACTTGGGCCAGCAGGTTCAGTTTAGCCTGTGGGTGCTGCGGTATGTGGTCTCTGGAGGGCTGTTTGTCCTGGGTCTCTGGGCCCCTGGACTTCGTCCCCAGTCCTATACATTGCAGGTTCATGAAGAGGACCAAGATGTGGAAAGGAGCCAGGTTCGGTCAGCAGCCCAACAGTCTACCTGGCGAGATTTTGGCAGGAAGCTCCGCCTCCTGAGTGGCTACCTGTGGCCTCGAGGGAGTCCAGCTCTGCAGCTGGTGGTGCTCATCTGCCTGGGGCTCATGGGTTTGGAACGGGCACTCAATGTGTTGGTGCCTATATTCTATAGGAACATTGTGAACTTGCTGACTGAGAAGGCACCTTGGAACTCTCTGGCCTGGACTGTTACCAGTTACGTCTTCCTCAAGTTCCTCCAGGGGGGTGGCACTGGCAGTACAGGCTTCGTGAGCAACCTGCGCACCTTCCTGTGGATCCGGGTGCAGCAGTTCACGTCTCGGCGGGTGGAGCTGCTCATCTTCTCCCACCTGCACGAGCTCTCACTGCGCTGGCACCTGGGGCGCCGCACAGGGGAGGTGCTGCGGATCGCGGATCGGGGCACATCCAGTGTCACAGGGCTGCTCAGCTACCTGGTGTTCAATGTCATCCCCACGCTGGCCGACATCATCATTGGCATCATCTACTTCAGCATGTTCTTCAACGCCTGGTTTGGCCTCATTGTGTTCCTGTGCATGAGTCTTTACCTCACCCTGACCATTGTGGTCACTGAGTGGAGAACCAAGTTTCGTCGTGCTATGAACACACAGGAGAACGCTACCCGGGCACGAGCAGTGGACTCTCTGCTAAACTTCGAGACGGTGAAGTATTACAACGCCGAGAGTTACGAAGTGGAACGCTATCGAGAGGCCATCATCAAATATCAGGGTTTGGAGTGGAAGTCGAGCGCTTCACTGGTTTTACTAAATCAGACCCAGAACCTGGTAATTGGGCTCGGGCTCCTCGCCGGCTCCCTGCTTTGCGCATACTTTGTCACTGAGCAGAAGCTACAGGTTGGGGACTATGTGCTCTTTGGCACCTACATTATCCAGCTGTACATGCCCCTCAATTGGTTTGGCACCTACTACAGGATGATCCAGACCAACTTCATTGACATGGAGAACATGTTTGACTTGCTGAAAGAGGAGACAGAAGTGAAGGACCTTCCTGGAGCAGGGCCCCTTCGCTTTCAGAAGGGCCGTATTGAGTTTGAGAACGTGCACTTCAGCTATGCCGATGGGCGGGAGACTCTGCAGGACGTGTCTTTCACTGTGATGCCTGGACAGACACTTGCCCTGGTGGGCCCATCTGGGGCAGGGAAGAGCACAATTTTGCGCCTGCTGTTTCGCTTCTACGACATCAGCTCTGGCTGCATCCGAATAGATGGGCAGGACATTTCACAGGTGACCCAGGCCTCTCTCCGGTCTCACATTGGAGTTGTGCCCCAAGACACTGTCCTCTTTAATGACACCATCGCCGACAATATCCGTTACGGCCGTGTCACAGCTGGGAATGATGAGGTGGAGGCTGCTGCTCAGGCTGCAGGCATCCATGATGCCATTATGGCTTTCCCTGAAGGGTACAGGACACAGGTGGGCGAGCGGGGACTGAAGCTGAGCGGCGGGGAGAAGCAGCGCGTCGCCATTGCCCGCACCATCCTCAAGGCTCCGGGCATCATTCTGCTGGATGAGGCAACGTCAGCGCTGGATACATCTAATGAGAGGGCCATCCAGGCTTCTCTGGCCAAAGTCTGTGCCAACCGCACCACCATCGTAGTGGCACACAGGCTCTCAACTGTGGTCAATGCTGACCAGATCCTCGTCATCAAGGATGGCTGCATCGTGGAGAGGGGACGACACGAGGCTCTGTTGTCCCGAGGTGGGGTGTATGCTGACATGTGGCAGCTGCAGCAGGGACAGGAAGAAACCTCTGAAGACACTAAGCCTCAGACCATGGAACGGTGA

Length: 2529

View AllClose

0 Reviews

View AllClose